ZNF423 Human qPCR Primer Pair (NM_015069)
$142.00
5 Days*
| Product Data | |
| Locus ID | 23090 |
|---|---|
| Forward Sequence | CAAGTGCCAGATGACCTTCGAG |
| Reverse Sequence | GGAGTCGAACATCTGGTTGCAC |
| ACCN | NM_015069, NM_015069.1, NM_015069.2, NM_015069.3, NM_015069.4, BC112315, BC112317, BM674965, BU733621 |
| UniProt ID | Q2M1K9 |
| Synonyms | Ebfaz; hOAZ; JBTS19; NPHP14; OAZ; Roaz; Zfp104; ZFP423 |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
Write Your Own Review
| Product Manuals |
| FAQs |
Related Products
Check items to add to the cart or
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.