Ikaros (IKZF1) Human qPCR Primer Pair (NM_006060)
$142.00
5 Days*
Product Data | |
Locus ID | 10320 |
---|---|
Forward Sequence | GCTGCCACAACTACTTGGAAAGC |
Reverse Sequence | AGTCTGTCCAGCACGAGAGATC |
ACCN | NM_006060, NM_006060.1, NM_006060.2, NM_006060.3, NM_006060.4, NM_006060.5, BC018349, BC064594, BC075820, BF797348, BI767330, BM148203, BT009836, BU537824, BU665456, NM_006060.6 |
UniProt ID | Q13422 |
Synonyms | CVID13; Hs.54452; IK1; IKAROS; LyF-1; LYF1; PPP1R92; PRO0758; ZNFN1A1 |
Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Shipping | Ambient |
Write Your Own Review
Product Manuals |
FAQs |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.