Ikaros (IKZF1) Human qPCR Primer Pair (NM_006060)

SKU HP209075

qSTAR qPCR primer pairs against Homo sapiens gene IKZF1

Product Data

• Locus ID: 10320
• Forward Sequence: GCTGCCACAACTACTTGGAAAGC
• Reverse Sequence: AGTCTGTCCAGCACGAGAGATC
• ACCN: NM_006060, NM_006060.1, NM_006060.2, NM_006060.3, NM_006060.4, NM_006060.5, BC018349, BC064594, BC075820, BF797348, BI767330, BM148203, BT009836, BU537824, BU665456, NM_006060.6
• UniProt ID: Q13422
• Synonyms: CVID13; Hs.54452; IK1; IKAROS; LyF-1; LYF1; PPP1R92; PRO0758; ZNFN1A1
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient