MFI2 (MELTF) Human qPCR Primer Pair (NM_005929)

SKU HP208973

qSTAR qPCR primer pairs against Homo sapiens gene MFI2

Product Data

• Locus ID: 4241
• Forward Sequence: AACAGCCAGGAGCGGTATTACG
• Reverse Sequence: GTCAAAGACGGTTGTGTGCCTG
• ACCN: NM_005929, NM_005929.1, NM_005929.2, NM_005929.3, NM_005929.4, NM_005929.5, BC001875, BC002623, BC007550, BC032752, BC034933, BC053510, BC068085, BC071910, BC082761, BC093920, BC111947, BC143257, BC152832, BQ332373, BQ447289, BT007377, NM_005929.6
• UniProt ID: P08582
• Synonyms: CD228; MAP97; MFI2; MTf; MTF1
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient