P2RY5 (LPAR6) Human qPCR Primer Pair (NM_005767)

SKU HP208845

qSTAR qPCR primer pairs against Homo sapiens gene LPAR6

Product Data

• Locus ID: 10161
• Forward Sequence: GCTCAGTAGTGGCAGCAGTAAG
• Reverse Sequence: GTCACTTCTCCTGACAGACCAG
• ACCN: NM_005767, NM_005767.1, NM_005767.2, NM_005767.3, NM_005767.4, NM_005767.5, BC045651, BC045651.1, BC039373, BC040850, BC054346, BC070295, BC106756, BF950635, BF951153, BQ006077, BX537392, BX537438, BX537445, BX647109, NM_005767.7
• UniProt ID: P43657
• Synonyms: ARWH1; HYPT8; LAH3; LPA-6; P2RY5; P2Y5
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient