Estrogen Related Receptor alpha (ESRRA) Human qPCR Primer Pair (NM_004451)

SKU HP207759

qSTAR qPCR primer pairs against Homo sapiens gene ESRRA

Product Data

• Locus ID: 2101
• Forward Sequence: CCACTATGGTGTGGCATCCTGT
• Reverse Sequence: GGTGATCTCACACTCGTTGGAG
• ACCN: NM_004451, NM_004451.1, NM_004451.2, NM_004451.3, NM_004451.4, BC063795, BC007915, BC011528, BC033701, BC073956, BC092470, BC093720, BC093722, NM_004451.5
• UniProt ID: P11474
• Synonyms: ERR1; ERRa; ERRalpha; ESRL1; NR3B1
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient