HSPA6 Human qPCR Primer Pair (NM_002155)
$142.00
5 Days*
Product Data | |
Locus ID | 3310 |
---|---|
Forward Sequence | GCTGAGCAAGATGAAGGAGACG |
Reverse Sequence | GATGATCCGCAACACGTTGAGC |
ACCN | NM_002155, NM_002155.1, NM_002155.2, NM_002155.3, NM_002155.4, BC035665, BC035665.1, BC004279, BQ008960, BQ217460 |
UniProt ID | P17066 |
Synonyms | HSP70B' |
Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Shipping | Ambient |
Write Your Own Review
Product Manuals |
FAQs |
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.