H3.3A (H3F3A) Human qPCR Primer Pair (NM_002107)
$142.00
5 Days*
| Product Data | |
| Locus ID | 3020 |
|---|---|
| Forward Sequence | ACAAAAGCCGCTCGCAAGAGTG |
| Reverse Sequence | TTTCTCGCACCAGACGCTGGAA |
| ACCN | NM_002107, NM_002107.1, NM_002107.2, NM_002107.3, NM_002107.4, BC081561, BC081561.1, NM_002107.5, BC013857, BC029405, BC038989, BC095447, BM760856, NM_002107.7 |
| UniProt ID | P84243 |
| Synonyms | H3-3B; H3.3A; H3F3; H3F3A |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
Write Your Own Review
| Product Manuals |
| FAQs |
Related Products
Check items to add to the cart or
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.