GAPDH Human qPCR Primer Pair (NM_002046)

CAT#: HP205798

qSTAR qPCR primer pairs against Homo sapiens gene GAPDH

USD 95.00

Availability*
5 Days
Size
    • 200 rxns
Cited in 20 publications.

Product images

Related Products (1)

NP100041

First Strand cDNA Synthesis Kit (11801-025)

    • 25 rxns

USD 140.00

Previous
Next

Specifications

Product Data
Gene ID 2597
Forward Sequence GTCTCCTCTGACTTCAACAGCG
Reverse Sequence ACCACCCTGTTGCTGTAGCCAA
Accession No NM_001256799, NM_001289745, NM_001289746, NM_002046, XM_032379, XM_033258, XM_033263, XM_088619, XM_088626
Synonyms G3PD; GAPD; HEL-S-162eP
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping when stored at -20 degrees C
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (20)

The use of this Gene Expression has been cited in the following citations:
Assessing stemness and proliferation properties of the newly established colon cancer 'stem' cell line, CSC480 and novel approaches to identify dormant cancer cells ,Alowaidi, F;Hashimi, SM;Alqurashi, N;Alhulais, R;Ivanovski, S;Bellette, B;Meedenyia, A;Lam, A;Wood, S;, Oncol. Rep. 2018 ,PubMed ID 29693155 [GAPDH]
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics ,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;, Cell Rep 2017 ,PubMed ID 28834758 [GAPDH]
Dengue virus compartmentalization during antibody-enhanced infection. ,Ong, EZ;Zhang, SL;Tan, HC;Gan, ES;Chan, KR;Ooi, EE;, Sci Rep 2017 ,PubMed ID 28084461 [GAPDH]
Cyclophosphamide promotes breast cancer cell migration through CXCR4 and matrix metalloproteinases. ,Hung, CM;Hsu, YC;Chen, TY;Chang, CC;Lee, MJ;, Cell Biol. Int 2016 ,PubMed ID 28035725 [GAPDH]
Increased epidermal thickness and abnormal epidermal differentiation in keloid scars ,Limandjaja, GC;van den Broek, LJ;Waaijman, T;van Veen, HA;Everts, V;Monstrey, S;Scheper, RJ;Niessen, FB;Gibbs, S;, Br. J. Dermatol. 2016 ,PubMed ID 27377288 [GAPDH]
Serum availability affects expression of common house-keeping genes in colon adenocarcinoma cell lines: implications for quantitative real-time PCR studies ,Krzystek-Korpacka, M;Hotowy, K;Czapinska, E;Podkowik, M;Bania, J;Gamian, A;Bednarz-Misa, I;, Cytotechnology 2016 ,PubMed ID 27339468 [GAPDH]
PKC epsilon Promotes Synaptogenesis through Membrane Accumulation of the Postsynaptic Density Protein PSD-95 ,Sen, A;Hongpaisan, J;Wang, D;Nelson, TJ;Alkon, DL;, J. Biol. Chem. Jun 2016 ,PubMed ID 27330081 [GAPDH]
Host glycosylation pathways and the unfolded protein response contribute to the infection by Francisella ,Barel, M;Harduin-Lepers, A;Portier, L;Slomianny, MC;Charbit, A;, Cell. Microbiol. May 2016 ,PubMed ID 27185209 [GAPDH]
Sulfotransferase-1A1-dependent bioactivation of aristolochic acid I and N-hydroxyaristolactam I in human cells ,Hashimoto, K;Zaitseva, IN;Bonala, R;Attaluri, S;Ozga, K;Iden, CR;Johnson, F;Moriya, M;Grollman, AP;Sidorenko, VS;, Carcinogenesis Apr 2016 ,PubMed ID 27207664 [GAPDH]
MicroRNA-153 is a prognostic marker and inhibits cell migration and invasion by targeting SNAI1 in human pancreatic ductal adenocarcinoma ,Bai, Z;Sun, J;Wang, X;Wang, H;Pei, H;Zhang, Z;, Oncol. Rep. Jun 2015 ,PubMed ID 26062664 [GAPDH]
Anti-proliferative effects of ?-tocotrienol are associated with suppression of c-Myc expression in mammary tumour cells ,Parajuli, P;Tiwari, RV;Sylvester, PW;, Cell Prolif. Jun 2015 ,PubMed ID 26096843 [GAPDH]
In vivo delivery of transcription factors with multifunctional oligonucleotides ,Lee, K;Rafi, M;Wang, X;Aran, K;Feng, X;Lo Sterzo, C;Tang, R;Lingampalli, N;Kim, HJ;Murthy, N;, Nat Mater Apr 2015 ,PubMed ID 25915034 [GAPDH]
A Mechanistic Investigation of Fc? R Signaling During Antibody-enhanced Dengue Infection ,ONG ZIYING, E;, Thesis Feb 2015 [GAPDH]
MicroRNA-520g induces epithelial-mesenchymal transition and promotes metastasis of hepatocellular carcinoma by targeting SMAD7 ,Kan, H;Guo, W;Huang, Y;Liu, D;, FEBS Lett. Jan 2015 ,PubMed ID 25436421 [GAPDH]
Expression Stability of Common Housekeeping Genes Is Differently Affected by Bowel Inflammation and Cancer: Implications for Finding Suitable Normalizers for Inflammatory Bowel Disease Studies ,Krzystek-Korpacka, M;Diakowska, D;Bania, J;Gamian, A;, Inflamm. Bowel Dis. May 2014 ,PubMed ID 24859298 [GAPDH]
A cellular model of amyloid precursor protein processing and amyloid-Beta peptide production ,Macias, MP;Gonzales, AM;Siniard, AL;Walker, AW;Corneveaux, JJ;Huentelman, MJ;Sabbagh, MN;Decourt, B;, J. Neurosci. Methods Dec 2013. ,PubMed ID 24333289 [GAPDH]
NAC1, A POZ/BTB protein interacts with Parkin and may contribute to Parkinson's disease ,Korutla, L;Furlong, HA;Mackler, SA;, Neuroscience Nov 2013 ,PubMed ID 24231739 [GAPDH]
Human papillomavirus type 16 E7 oncoprotein inhibits the anaphase promoting complex/cyclosome activity by dysregulating EMI1 expression in mitosis ,Yu, Y;Munger, K;, Virology. 2013 Nov;446(1-2):251-9. doi: 10.1016/j.virol.2013.08.013 ,PubMed ID 24074588 [GAPDH]
The Human Papillomavirus Type 8 E6 Protein Interferes with NOTCH Activation during Keratinocyte Differentiation ,Jordan M. Meyers, Jennifer M. Spangle, and Karl Munger, J. Virol., Apr 2013; 87: 4762 - 4767. ,PubMed ID 23365452 [GAPDH]
Nitric Oxide–Producing Myeloid-Derived Suppressor Cells Inhibit Vascular E-Selectin Expression in Human Squamous Cell Carcinomas ,Ahmed E Gehad, Michael K Lichtman, Chrysalyne D Schmults, Jessica E Teague, Adam W Calarese, Ying Jiang, Rei Watanabe & Rachael A Clark, Journal of Investigative Dermatology doi:10.1038/jid.2012.190 [GAPDH]

Documents

FAQs
48 Mouse Clones

Also for "GAPDH"

Expression Plasmids
Lentiviral Particles
CRISPR
RNAi
Proteins
Antibodies