GAPDH Human qPCR Primer Pair (NM_002046)

CAT#: HP205798

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene GAPDH


Product Datasheet for 'HP205798'


 Cited in 36 publications.

USD 120.00


Availability*
2 Weeks

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 2597
Forward Sequence GTCTCCTCTGACTTCAACAGCG
Reverse Sequence ACCACCCTGTTGCTGTAGCCAA
Accession No NM_001256799, NM_001289745, NM_001289746, NM_002046, NM_001357943, NR_152150, BC009081, BC001601, BC004109, BC013310, BC020308, BC023632, BC025925, BC026907, BC029340, BC029618, BC083511, BE893087, BG724119, BI463134, BM763361, BT006893, BU155402
Synonyms G3PD; GAPD; HEL-S-162eP
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.

Citations (36)

Other products for "GAPDH"
Frequently bought together (7)
Mouse monoclonal anti-GAPDH antibody, clone OTI2D9 (formerly 2D9), loading control
    • 100 ul

USD 295.00


GAPDH (myc-DDK-tagged) - Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transcript variant 3
    • 10 ug

USD 420.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 140.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 440.00


GAPDH (myc-DDK-tagged) - Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transcript variant 4
    • 10 ug

USD 420.00


GAPDH (Myc-DDK tagged) - Homo sapiens glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transcript variant 2
    • 10 ug

USD 420.00


GAPDH (Myc-DDK-tagged)-Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
    • 10 ug

USD 420.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools