Ferritin Heavy Chain (FTH1) Human qPCR Primer Pair (NM_002032)

SKU HP205786

qSTAR qPCR primer pairs against Homo sapiens gene FTH1

Product Data

• Locus ID: 2495
• Forward Sequence: TGAAGCTGCAGAACCAACGAGG
• Reverse Sequence: GCACACTCCATTGCATTCAGCC
• ACCN: NM_002032, NM_002032.1, NM_002032.2, BC066961, BC066961.1, BC000857, BC001399, BC011359, BC013724, BC015156, BC015946, BC016009, BC016857, BC020300, BC035441, BC063514, BC066341, BC070494, BC073750, BC104643, BC105802, BM971420, BQ887222, NM_002032.3
• UniProt ID: P02794
• Synonyms: FHC; FTH; FTHL6; HFE5; PIG15; PLIF
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient