cIAP2 (BIRC3) Human qPCR Primer Pair (NM_001165)
USD 142.00
5 Days*
Size
Product Images
Frequently bought together (4)
BIRC3 (Myc-DDK-tagged)-Human baculoviral IAP repeat containing 3 (BIRC3), transcript variant 1
USD 843.00
Other products for "BIRC3"
Specifications
Product Data | |
Gene ID | 330 |
Forward Sequence | GCTTTTGCTGTGATGGTGGACTC |
Reverse Sequence | CTTGACGGATGAACTCCTGTCC |
Accession No | NM_001165, NM_001165.2, NM_001165.3, NM_001165.4, BC037420, BC037420.1, BC027485, BE907592, BG569841, BQ718651, BU428906, BX415415, BX475964, NM_001165.5 |
UniProt ID | Q13489 |
Synonyms | AIP1; API2; c-IAP2; CIAP2; HAIP1; HIAP1; IAP-1; MALT2; MIHC; RNF49 |
Component | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions) |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage | Store at -20°C. |
Stability | The primer mix is stable for one year from date of shipping. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.