cIAP2 (BIRC3) Human qPCR Primer Pair (NM_001165)
$142.00
5 Days*
| Product Data | |
| Locus ID | 330 |
|---|---|
| Forward Sequence | GCTTTTGCTGTGATGGTGGACTC |
| Reverse Sequence | CTTGACGGATGAACTCCTGTCC |
| ACCN | NM_001165, NM_001165.2, NM_001165.3, NM_001165.4, BC037420, BC037420.1, BC027485, BE907592, BG569841, BQ718651, BU428906, BX415415, BX475964, NM_001165.5 |
| UniProt ID | Q13489 |
| Synonyms | AIP1; API2; c-IAP2; CIAP2; HAIP1; HIAP1; IAP-1; MALT2; MIHC; RNF49 |
| Components | 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM. |
| Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
| Storage | Store at -20°C. |
| Stability | The primer mix is stable for one year from date of shipping. |
| Shipping | Ambient |
Write Your Own Review
| Product Manuals |
| FAQs |
Related Products
Check items to add to the cart or
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.