ACTB Human qPCR Primer Pair (NM_001101)

CAT#: HP204660

qSTAR qPCR primer pairs against Homo sapiens gene ACTB

 Cited in 20 publications.

USD 100.00


Availability*
5 Days

Size
    • 200 rxns

Product images

Specifications

Product Data
Gene ID 60
Forward Sequence CACCATTGGCAATGAGCGGTTC
Reverse Sequence AGGTCTTTGCGGATGTCCACGT
Accession No E01452, NM_001101
Synonyms BRWS1; PS1TP5BP1
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT
Storage & Stability The primer mix is stable for one year from date of shipping. Store at -20°C.

Citations (20)

Other products for "ACTB"
Frequently bought together (2)
beta Actin Mouse Monoclonal Antibody, Clone OTI1, Loading Control
    • 30 ul

USD 150.00


ACTB (Myc-DDK-tagged)-Human actin, beta (ACTB)
    • 10 ug

USD 410.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones