RPL6 Human qPCR Primer Pair (NM_000970)

SKU HP200907

qSTAR qPCR primer pairs against Homo sapiens gene RPL6

Product Data

• Locus ID: 6128
• Forward Sequence: CCTTGTCAGAGGAATTGGCAGG
• Reverse Sequence: GTAACAGTTGCGAGAACCTTCTC
• ACCN: NM_000970, NM_000970.1, NM_000970.2, NM_000970.3, NM_000970.4, BC004138, BC004138.2, BC022444, BC022444.1, BC104826, BC104826.1, BC013863, BC020679, BC031009, BC032299, BC070195, BC071912, BC104824, BG030827, BG722198, BP285025, BP308263, BU940020, NM_000970.5
• UniProt ID: Q02878
• Synonyms: L6; SHUJUN-2; TAXREB107; TXREB1
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient