PLAT Human qPCR Primer Pair (NM_000930)

SKU HP200868

qSTAR qPCR primer pairs against Homo sapiens gene PLAT

Product Data

• Locus ID: 5327
• Forward Sequence: TGGTGCTACGTCTTTAAGGCGG
• Reverse Sequence: GCTGACCCATTCCCAAAGTAGC
• ACCN: NM_000930, NM_000930.1, NM_000930.2, NM_000930.3, NM_000930.4, BC002795, BC002795.2, BC095403, BC095403.1, BC007231, BC013968, BC018636, BT007060, BX641021, NM_000930.5
• UniProt ID: P00750
• Synonyms: T-PA; TPA
• Components: 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
• Quality Control: The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
• Storage: Store at -20°C.
• Stability: The primer mix is stable for one year from date of shipping.
• Shipping: Ambient