OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TNF alpha (TNF) Human qPCR Primer Pair (NM_000594)

Be the first to review this product
SKU
HP200561
qSTAR qPCR primer pairs against Homo sapiens gene TNF
  $150.00
In Stock*

Frequently Bought Together (4)

TA506513 TNF mouse monoclonal antibody, clone OTI1C1 (formerly 1C1) 100 ul
$447.00
NP100055 A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
4 x 1.25 ml (500 rxns/20ul reaction)
$370.00
RC206983 TNF (Myc-DDK-tagged)-Human tumor necrosis factor (TNF)
10 ug
$450.00
NP100042 First Strand cDNA Synthesis Kit (11801-100)
100 reactions
$540.00

Other products for "TNF or NM_000594"

Specifications
Specifications
Product Data
Locus ID 7124
Forward Sequence CTCTTCTGCCTGCTGCACTTTG
Reverse Sequence ATGGGCTACAGGCTTGTCACTC
ACCN NM_000594, NM_000594.1, NM_000594.2, NM_000594.3, BC028148, BC028148.1, BI908079, BP215875, NM_000594.4
UniProt ID P01375
Synonyms DIF; TNF-alpha; TNFA; TNFSF2; TNLG1F
Components 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions). Before use, reconstitute the primer mix in 200 µl dH2O to make a final concentration of 10 µM.
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage Store at -20°C.
Stability The primer mix is stable for one year from date of shipping.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Galantamine Attenuates Aluminum Chloride-Induced Cytotoxicity and Modulates Tumor Necrosis Factor Expression in SH-SY5Y Cells
Mahmoud, Ghaleb
International Journal of Medical (2026)
AI Summary: In this paper, OriGene's TNF qPCR primer pair (catalog no. HP200561) was used to measure tumor necrosis factor (TNF) gene expression in SH-SY5Y cells.
Snippet: 5′ATGGGCTACAGGCTTGTCACTC-3′, yielding a 135-bp amplicon;these sequences correspond to the OriGene TNF qPCR primer pair, catalog no. HP200561 [12]. For
Ameliorating effect of S-Allyl cysteine (Black Garlic) on 6-OHDA mediated neurotoxicity in SH-SY5Y cell line
Yeni, Cicek, Yildirim et al
Toxicol Rep (2024) 13, 101762 DOI: 10.1016/j.toxrep.2024.101762
Cited by 5
Snippet: ded at 450 nm using a microplate reader. 2.4 Determination of TNF-α, IL-1, and IL-8 expression levels To measure the expression levels of IL-1 (HP200544), IL-8 (HP200551), and TNF- α (HP200561) (Origene, USA) in cultured SY-SH5Y, we first extracted total RNA with the High Pure RNA Isolation kit (Roche, USA). Switzerland), then the Transcriptor First Strand cDNA Synthesis kit (Roche, Switzerla
FigureFigureFigure
Reactivated endogenous retroviruses promote protein aggregate spreading
Liu, Heumüller, Hossinger et al
Nat Commun (2023) 14 (1), 5034 DOI: 10.1038/s41467-023-40632-z
Cited by 47
AI Summary: OriGene products contributed to this study by providing qPCR primer pairs for murine IFN-ß (#MP206681) and human cytokines IFN-ß (#HP205913) and IL1ß (#HP200544), which were used to measure gene expression related to the investigation of endogenous retrovirus activation and protein aggregate spreading.
Snippet: . pPCR primers for murine IFN- ß were from Origene (#MP206681). Primer pairs for human cytokines were from Origene: IFN- ß (#HP205913);IL1 ß (#HP200544);TNF-α (
FigureFigureFigure
Molecular Aspects of Hypoxic Stress Effects in Chronic Ethanol Exposure of Neuronal Cells
Stoica, Onose, Pitica et al
Curr Issues Mol Biol (2023) 45 (2), 1655-1680 DOI: 10.3390/cimb45020107
Cited by 9
AI Summary: In this study, OriGene products—specifically qPCR primer pairs for Casp7 (HP233752), Casp9 (HP205155), Casp8 (HP234494), Casp10 (HP228052), and GasderminD (HP214995)—were used to measure gene expression changes related to cell death pathways in neuronal cells under hypoxic stress and chronic ethanol exposure.
Snippet: IL-6 (Hs00174131_m1), IL-10 (Hs00174086_m1), TIMP3 (Hs00165949_m1), VEGF-a (Hs00900055_m1), HIF1 (Hs00153153_m1), PCDH12 (Hs00170986_m1), and FLT1 (VEGFR) (Hs01052961_m1) and using qPCR primer pairs (OriGene Technologies, Inc., Rockville, USA) for the following genes: Casp7 (CAT#: HP233752), Casp9 (CAT#: HP205155), Casp8 (CAT#: HP234494), Casp10 (CAT#: HP228052), GasderminD (CAT#: HP214995), RIPK1
FigureFigureFigure
The HMGB1-AGER-STING1 pathway mediates the sterile inflammatory response to alkaliptosis
Fang, Dai, Bai et al
Biochem Biophys Res Commun (2021) 560, 165-171 DOI: 10.1016/j.bbrc.2021.05.003
Cited by 32
AI Summary: OriGene’s predesigned qPCR primers for TNF (#HP200561), IL6 (#HP200567), and IFNA1 (#HP214678) were used to measure cytokine gene expression, helping the authors assess the inflammatory response during alkaliptosis.
Snippet: The cDNA from various cell samples was then amplified by real-time quantitative polymerase chain reaction (qPCR) with predesigned primers (TNF: #HP200561;IL6: #HP200567;IFNA1: #HP214678) from OriGene using an CFX96 Touch Real-Time PCR Detection;- The cDNA from various cell samples was then amplified by real-time quantitative polymerase chain reaction (qPCR) with predesigned primers (TNF: #HP200561
Upregulation of CBP by PLY can cause permeability of blood-brain barrier to increase meningitis
Chen, Li, Wang et al
J. Biochem. Mol. Toxicol. (2019)
AI Summary: OriGene's qPCR Primer Pairs for CBP, p300, and IL-10 were used in this study to measure gene expression changes that helped elucidate how pneumolysin (PLY) increases blood-brain barrier permeability in pneumococcal meningitis.
Snippet: expression. The primers of IL‐6, IL‐8, and GAPDH were previously described and the primers of CBP, p300 as well as IL‐10 were from the available qPCR Primer Pairs of OriGene Technologies (Rockville, MD) (Table 1).8. Table
Showing 1-6 of 9 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products