IL8 (CXCL8) Human qPCR Primer Pair (NM_000584)

CAT#: HP200551

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene CXCL8



SensiMix SYBR Master Mix

USD 142.00

In Stock*

Size
    • 200 reactions

Product images

Frequently bought together (3)
IL8 (Myc-DDK-tagged)-Human interleukin 8 (IL8)
    • 10 ug

USD 150.00 USD 225.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 165.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 518.00

Other products for "CXCL8"

Specifications

Product Data
Gene ID 3576
Forward Sequence GAGAGTGATTGAGAGTGGACCAC
Reverse Sequence CACAACCCTCTGCACCCAGTTT
Accession No NM_000584, NM_001354840, NM_000584.1, NM_000584.2, NM_000584.3, BC013615, BG497712, BT007067, NM_000584.4
UniProt ID P10145
Synonyms GCP-1; GCP1; IL8; LECT; LUCT; LYNAP; MDNCF; MONAP; NAF; NAP-1; NAP1; SCYB8
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.
Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.