SOX9 Human qPCR Primer Pair (NM_000346)

CAT#: HP200327

Reviews ()
Write a review

qSTAR qPCR primer pairs against Homo sapiens gene SOX9



SensiMix SYBR Master Mix

USD 132.00


Availability*
5 Days

Size
    • 200 reactions

Product images

Specifications

Product Data
Gene ID 6662
Forward Sequence AGGAAGCTCGCGGACCAGTAC
Reverse Sequence GGTGGTCCTTCTTGTGCTGCAC
Accession No NM_000346, NM_000346.1, NM_000346.2, NM_000346.3, BC056420, BC056420.1, BC007951, BC018276, BT006875, NM_000346.4
UniProt ID P48436
Synonyms CMD1; CMPD1; SRA1; SRXX2; SRXY10
Component 1 vial of lyophilized qSTAR qPCR primer mix (1 nmol each primer, sufficient for 200 reactions)
Quality Control The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec.
Storage The primer mix is stable for one year from date of shipping. Store at -20°C.
Other products for "SOX9"
Frequently bought together (4)
SOX9 mouse monoclonal antibody, clone OTI2H10 (formerly 2H10)
    • 100 ul

USD 417.00


SOX9 (Myc-DDK-tagged)-Human SRY (sex determining region Y)-box 9 (SOX9)
    • 10 ug

USD 544.00


First Strand cDNA Synthesis Kit (11801-025)
    • 25 reactions

USD 154.00


First Strand cDNA Synthesis Kit (11801-100)
    • 100 reactions

USD 484.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools