GAPDH Human Gene Knockout Kit (CRISPR)

CAT#: KN402309

Reviews ()
Write a review

GAPDH - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated.

KN2.0 knockout kit validation

  See Other Versions

KN402309 is the updated version of KN202309.

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 linear donor
Donor DNA EF1a-GFP-P2A-Puro
Symbol GAPDH
Locus ID 2597
Kit Components

KN402309G1, GAPDH gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TCGCTCAGACACCATGGGGA

KN402309G2, GAPDH gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGAAAGCGTCCCCCACCTAG

KN402309D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001256799, NM_001289745, NM_001289746, NM_002046, NM_001357943, NR_152150
Synonyms G3PD; GAPD; HEL-S-162eP
Summary This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The product of this gene catalyzes an important energy-yielding step in carbohydrate metabolism, the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD). The encoded protein has additionally been identified to have uracil DNA glycosylase activity in the nucleus. Also, this protein contains a peptide that has antimicrobial activity against E. coli, P. aeruginosa, and C. albicans. Studies of a similar protein in mouse have assigned a variety of additional functions including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Many pseudogenes similar to this locus are present in the human genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]


Other Versions

Other products for "GAPDH"
Frequently bought together (2)
Mouse monoclonal anti-GAPDH antibody, clone OTI2D9 (formerly 2D9), loading control
    • 100 ul

USD 295.00

GAPDH (myc-DDK-tagged) - Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transcript variant 4
    • 10 ug

USD 420.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools