SOX2 Human Gene Knockout Kit (CRISPR)

CAT#: KN400757

SOX2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated.



KN2.0 knockout kit validation

  See Other Versions

USD 1,657.00

2 Weeks*

Size
    • 1 kit

Product Images

Frequently bought together (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

USD 450.00


Rabbit monoclonal anti-Sox2 Antibody, clone OTIR-2D11
    • 100 ul

USD 516.00


SOX2 (Myc-DDK-tagged)-Human SRY (sex determining region Y)-box 2 (SOX2)
    • 10 ug

USD 450.00

Other products for "SOX2"

Specifications

Product Data
Format 2 gRNA vectors, 1 linear donor
Donor DNA EF1a-GFP-P2A-Puro
Symbol SOX2
Locus ID 6657
Components

KN400757G1, SOX2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CTCGGAGATCAGCAAGCGCC

KN400757G2, SOX2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CGCTTAGCCTCGTCGATGAA

KN400757D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP:

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

ATAACTTCGT ATAATGTATG CTATACGAAG TTATCGTGAG GCTCCGGTGC CCGTCAGTGG GCAGAGCGCA CATCGCCCAC AGTCCCCGAG AAGTTGGGGG GAGGGGTCGG CAATTGAACC GGTGCCTAGA GAAGGTGGCG CGGGGTAAAC TGGGAAAGTG ATGTCGTGTA CTGGCTCCGC CTTTTTCCCG AGGGTGGGGG AGAACCGTAT ATAAGTGCAG TAGTCGCCGT GAACGTTCTT TTTCGCAACG GGTTTGCCGC CAGAACACAG GTAAGTGCCG TGTGTGGTTC CCGCGGGCCT GGCCTCTTTA CGGGTTATGG CCCTTGCGTG CCTTGAATTA CTTCCACCTG GCTGCAGTAC GTGATTCTTG ATCCCGAGCT TCGGGTTGGA AGTGGGTGGG AGAGTTCGAG GCCTTGCGCT TAAGGAGCCC CTTCGCCTCG TGCTTGAGTT GAGGCCTGGC CTGGGCGCTG GGGCCGCCGC GTGCGAATCT GGTGGCACCT TCGCGCCTGT CTCGCTGCTT TCGATAAGTC TCTAGCCATT TAAAATTTTT GATGACCTGC TGCGACGCTT TTTTTCTGGC AAGATAGTCT TGTAAATGCG GGCCAAGATC TGCACACTGG TATTTCGGTT TTTGGGGCCG CGGGCGGCGA CGGGGCCCGT GCGTCCCAGC GCACATGTTC GGCGAGGCGG GGCCTGCGAG CGCGGCCACC GAGAATCGGA CGGGGGTAGT CTCAAGCTGG CCGGCCTGCT CTGGTGCCTG GCCTCGCGCC GCCGTGTATC GCCCCGCCCT GGGCGGCAAG GCTGGCCCGG TCGGCACCAG TTGCGTGAGC GGAAAGATGG CCGCTTCCCG GCCCTGCTGC AGGGAGCTCA AAATGGAGGA CGCGGCGCTC GGGAGAGCGG GCGGGTGAGT CACCCACACA AAGGAAAAGG GCCTTTCCGT CCTCAGCCGT CGCTTCATGT GACTCCACGG AGTACCGGGC GCCGTCCAGG CACCTCGATT AGTTCTCGAG CTTTTGGAGT ACGTCGTCTT TAGGTTGGGG GGAGGGGTTT TATGCGATGG AGTTTCCCCA CACTGAGTGG GTGGAGACTG AAGTTAGGCC AGCTTGGCAC TTGATGTAAT TCTCCTTGGA ATTTGCCCTT TTTGAGTTTG GATCTTGGTT CATTCTCAAG CCTCAGACAG TGGTTCAAAG TTTTTTTCTT CCATTTCAGG TGTCGTGAAT GGAGAGCGAC GAGAGCGGCC TGCCCGCCAT GGAGATCGAG TGCCGCATCA CCGGCACCCT GAACGGCGTG GAGTTCGAGC TGGTGGGCGG CGGAGAGGGC ACCCCCGAGC AGGGCCGCAT GACCAACAAG ATGAAGAGCA CCAAAGGCGC CCTGACCTTC AGCCCCTACC TGCTGAGCCA CGTGATGGGC TACGGCTTCT ACCACTTCGG CACCTACCCC AGCGGCTACG AGAACCCCTT CCTGCACGCC ATCAACAACG GCGGCTACAC CAACACCCGC ATCGAGAAGT ACGAGGACGG CGGCGTGCTG CACGTGAGCT TCAGCTACCG CTACGAGGCC GGCCGCGTGA TCGGCGACTT CAAGGTGATG GGCACCGGCT TCCCCGAGGA CAGCGTGATC TTCACCGACA AGATCATCCG CAGCAACGCC ACCGTGGAGC ACCTGCACCC CATGGGCGAT AACGATCTGG ATGGCAGCTT CACCCGCACC TTCAGCCTGC GCGACGGCGG CTACTACAGC TCCGTGGTGG ACAGCCACAT GCACTTCAAG AGCGCCATCC ACCCCAGCAT CCTGCAGAAC GGGGGCCCCA TGTTCGCCTT CCGCCGCGTG GAGGAGGATC ACAGCAACAC CGAGCTGGGC ATCGTGGAGT ACCAGCACGC CTTCAAGACC CCGGATGCAG ATGCCGGTGA AGAAAGAGGA AGCGGAGCTA CTAACTTCAG CCTGCTGAAG CAGGCTGGAG ACGTGGAGGA GAACCCTGGA CCTATGACCG AGTACAAGCC CACGGTGCGC CTCGCCACCC GCGACGACGT CCCCAGGGCC GTACGCACCC TCGCCGCCGC GTTCGCCGAC TACCCCGCCA CGCGCCACAC CGTCGATCCG GACCGCCACA TCGAGCGGGT CACCGAGCTG CAAGAACTCT TCCTCACGCG CGTCGGGCTC GACATCGGCA AGGTGTGGGT CGCGGACGAC GGCGCCGCGG TGGCGGTCTG GACCACGCCG GAGAGCGTCG AAGCGGGGGC GGTGTTCGCC GAGATCGGCC CGCGCATGGC CGAGTTGAGC GGTTCCCGGC TGGCCGCGCA GCAACAGATG GAAGGCCTCC TGGCGCCGCA CCGGCCCAAG GAGCCCGCGT GGTTCCTGGC CACCGTCGGC GTCTCGCCCG ACCACCAGGG CAAGGGTCTG GGCAGCGCCG TCGTGCTCCC CGGAGTGGAG GCGGCCGAGC GCGCCGGGGT GCCCGCCTTC CTGGAGACCT CCGCGCCCCG CAACCTCCCC TTCTACGAGC GGCTCGGCTT CACCGTCACC GCCGACGTCG AGGTGCCCGA AGGACCGCGC ACCTGGTGCA TGACCCGCAA GCCCGGTGCC TGAAACTTGT TTATTGCAGC TTATAATGGT TACAAATAAA GCAATAGCAT CACAAATTTC ACAAATAAAG CATTTTTTTC ACTGCATTCT AGTTGTGGTT TGTCCAAACT CATCAATGTA TCTTAATAAC TTCGTATAAT GTATGCTATA CGAAGTTAT

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_003106
UniProt ID P48431
Synonyms ANOP3; MCOPS3
Summary This intronless gene encodes a member of the SRY-related HMG-box (SOX) family of transcription factors involved in the regulation of embryonic development and in the determination of cell fate. The product of this gene is required for stem-cell maintenance in the central nervous system, and also regulates gene expression in the stomach. Mutations in this gene have been associated with optic nerve hypoplasia and with syndromic microphthalmia, a severe form of structural eye malformation. This gene lies within an intron of another gene called SOX2 overlapping transcript (SOX2OT). [provided by RefSeq, Jul 2008]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.