Interferon beta (IFNB1) Human Gene Knockout Kit (CRISPR)

SKU
KN218565
IFNB1 - human gene knockout kit via CRISPR, HDR mediated
$1,657.00
4 Weeks*
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol Interferon beta
Locus ID 3456
Components

KN218565G1, Interferon beta gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AATTTGGAGGAGACACTTGT

KN218565G2, Interferon beta gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCCAAGCAAGTTGTAGCTCA

KN218565D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_002176
UniProt ID P01574
Synonyms IFB; IFF; IFNB
Summary This gene encodes a cytokine that belongs to the interferon family of signaling proteins, which are released as part of the innate immune response to pathogens. The protein encoded by this gene belongs to the type I class of interferons, which are important for defense against viral infections. In addition, type I interferons are involved in cell differentiation and anti-tumor defenses. Following secretion in response to a pathogen, type I interferons bind a homologous receptor complex and induce transcription of genes such as those encoding inflammatory cytokines and chemokines. Overactivation of type I interferon secretion is linked to autoimmune diseases. Mice deficient for this gene display several phenotypes including defects in B cell maturation and increased susceptibility to viral infection. [provided by RefSeq, Sep 2015]
Shipping Ambient

More linear donor DNA can be ordered separately

Cat# KN218565D
Description 10 ug linear donor DNA for KN218565 kit
Price $515/€515
If you want to order 20ug, please order quantity of 2 for KN218565D
If you want to order 50ug, please order quantity of 5 for KN218565D

Other selection marker is available for donor DNA.
Please contact techsupport@origene.com for a custom quote.

different donor dna img
Write Your Own Review
You're reviewing:Interferon beta (IFNB1) Human Gene Knockout Kit (CRISPR)
Your Rating
SKU Description Size Price
GA102341 IFNB1 CRISPRa kit - CRISPR gene activation of human interferon beta 1 1 kit
$1,657.00
KN218565BN IFNB1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN218565LP IFNB1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN218565RB IFNB1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN418565 IFNB1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.