Interferon beta (IFNB1) Human Gene Knockout Kit (CRISPR)
$1,657.00
4 Weeks*
Product Data | |
Format | 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control |
---|---|
Vector | GFP-puro |
Target Symbol | Interferon beta |
Locus ID | 3456 |
Components |
KN218565G1, Interferon beta gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AATTTGGAGGAGACACTTGT KN218565G2, Interferon beta gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TCCAAGCAAGTTGTAGCTCA KN218565D, donor DNA containing left and right homologous arms and GFP-puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_002176 |
UniProt ID | P01574 |
Synonyms | IFB; IFF; IFNB |
Summary | This gene encodes a cytokine that belongs to the interferon family of signaling proteins, which are released as part of the innate immune response to pathogens. The protein encoded by this gene belongs to the type I class of interferons, which are important for defense against viral infections. In addition, type I interferons are involved in cell differentiation and anti-tumor defenses. Following secretion in response to a pathogen, type I interferons bind a homologous receptor complex and induce transcription of genes such as those encoding inflammatory cytokines and chemokines. Overactivation of type I interferon secretion is linked to autoimmune diseases. Mice deficient for this gene display several phenotypes including defects in B cell maturation and increased susceptibility to viral infection. [provided by RefSeq, Sep 2015] |
Shipping | Ambient |
More linear donor DNA can be ordered separately
Cat# | KN218565D |
Description | 10 ug linear donor DNA for KN218565 kit |
Price | $515/€515 |
If you want to order 50ug, please order quantity of 5 for KN218565D
Other selection marker is available for donor DNA.
Please contact
techsupport@origene.com
for a custom quote.

Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
GA102341 | IFNB1 CRISPRa kit - CRISPR gene activation of human interferon beta 1 | 1 kit |
$1,657.00
|
|
KN218565BN | IFNB1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN218565LP | IFNB1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN218565RB | IFNB1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN418565 | IFNB1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.