Telomerase reverse transcriptase (TERT) Human Gene Knockout Kit (CRISPR)
$1,657.00
2 Weeks*
Product Data | |
Format | 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control |
---|---|
Vector | Luciferase-Puro |
Target Symbol | Telomerase reverse transcriptase |
Locus ID | 7015 |
Components |
KN217436G1, Telomerase reverse transcriptase gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCCACGTTCGTGCGGCGCC KN217436G2, Telomerase reverse transcriptase gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ACCAGCGCGCGGAAAGCCGC KN217436LPD, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector |
OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001193376, NM_003219, NM_198253, NM_198254, NM_198255, NR_149162, NR_149163 |
UniProt ID | O14746 |
Synonyms | CMM9; DKCA2; DKCB4; EST2; hEST2; hTRT; PFBMFT1; TCS1; TP2; TRT |
Summary | Telomerase is a ribonucleoprotein polymerase that maintains telomere ends by addition of the telomere repeat TTAGGG. The enzyme consists of a protein component with reverse transcriptase activity, encoded by this gene, and an RNA component which serves as a template for the telomere repeat. Telomerase expression plays a role in cellular senescence, as it is normally repressed in postnatal somatic cells resulting in progressive shortening of telomeres. Deregulation of telomerase expression in somatic cells may be involved in oncogenesis. Studies in mouse suggest that telomerase also participates in chromosomal repair, since de novo synthesis of telomere repeats may occur at double-stranded breaks. Alternatively spliced variants encoding different isoforms of telomerase reverse transcriptase have been identified; the full-length sequence of some variants has not been determined. Alternative splicing at this locus is thought to be one mechanism of regulation of telomerase activity. [provided by RefSeq, Jul 2008] |
Shipping | Ambient |
More linear donor DNA can be ordered separately
Cat# | KN217436LPD |
Description | 10 ug linear donor DNA for KN217436LP kit |
Price | $515/€515 |
If you want to order 50ug, please order quantity of 5 for KN217436LPD
Other selection marker is available for donor DNA.
Please contact
techsupport@origene.com
for a custom quote.

Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
GA104825 | TERT CRISPRa kit - CRISPR gene activation of human telomerase reverse transcriptase | 1 kit |
$1,657.00
|
|
KN217436 | TERT - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN217436BN | TERT - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN217436RB | TERT - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN417436 | TERT - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.