ROR1 Human Gene Knockout Kit (CRISPR)

SKU
KN214967BN
ROR1 - human gene knockout kit via CRISPR, HDR mediated
$1,657.00
4 Weeks*
Specifications
Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Vector mBFP-Neo
Target Symbol ROR1
Locus ID 4919
Components

KN214967G1, ROR1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GCTGCTGCTGGCCGCACGCG

KN214967G2, ROR1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ATGCACCGGCCGCGCCGCCG

KN214967BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001083592, NM_005012
UniProt ID Q01973
Synonyms dJ537F10.1; NTRKR1
Summary This gene encodes a receptor tyrosine kinase-like orphan receptor that modulates neurite growth in the central nervous system. The encoded protein is a glycosylated type I membrane protein that belongs to the ROR subfamily of cell surface receptors. It is a pseudokinase that lacks catalytic activity and may interact with the non-canonical Wnt signalling pathway. This gene is highly expressed during early embryonic development but expressed at very low levels in adult tissues. Increased expression of this gene is associated with B-cell chronic lymphocytic leukaemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2012]
Shipping Ambient

More linear donor DNA can be ordered separately

Cat# KN214967BND
Description 10 ug linear donor DNA for KN214967BN kit
Price $515/€515
If you want to order 20ug, please order quantity of 2 for KN214967BND
If you want to order 50ug, please order quantity of 5 for KN214967BND

Other selection marker is available for donor DNA.
Please contact techsupport@origene.com for a custom quote.

different donor dna img
Write Your Own Review
You're reviewing:ROR1 Human Gene Knockout Kit (CRISPR)
Your Rating
SKU Description Size Price
GA103285 ROR1 CRISPRa kit - CRISPR gene activation of human receptor tyrosine kinase like orphan receptor 1 1 kit
$1,657.00
KN214967 ROR1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN214967LP ROR1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN214967RB ROR1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN414967 ROR1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.