ROR1 Human Gene Knockout Kit (CRISPR)
$1,657.00
4 Weeks*
Product Data | |
Format | 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control |
---|---|
Vector | mBFP-Neo |
Target Symbol | ROR1 |
Locus ID | 4919 |
Components |
KN214967G1, ROR1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GCTGCTGCTGGCCGCACGCG KN214967G2, ROR1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: ATGCACCGGCCGCGCCGCCG KN214967BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette. GE100003, scramble sequence in pCas-Guide vector |
OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process. |
Reference Data | |
RefSeq | NM_001083592, NM_005012 |
UniProt ID | Q01973 |
Synonyms | dJ537F10.1; NTRKR1 |
Summary | This gene encodes a receptor tyrosine kinase-like orphan receptor that modulates neurite growth in the central nervous system. The encoded protein is a glycosylated type I membrane protein that belongs to the ROR subfamily of cell surface receptors. It is a pseudokinase that lacks catalytic activity and may interact with the non-canonical Wnt signalling pathway. This gene is highly expressed during early embryonic development but expressed at very low levels in adult tissues. Increased expression of this gene is associated with B-cell chronic lymphocytic leukaemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2012] |
Shipping | Ambient |
More linear donor DNA can be ordered separately
Cat# | KN214967BND |
Description | 10 ug linear donor DNA for KN214967BN kit |
Price | $515/€515 |
If you want to order 50ug, please order quantity of 5 for KN214967BND
Other selection marker is available for donor DNA.
Please contact
techsupport@origene.com
for a custom quote.

Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
GA103285 | ROR1 CRISPRa kit - CRISPR gene activation of human receptor tyrosine kinase like orphan receptor 1 | 1 kit |
$1,657.00
|
|
KN214967 | ROR1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN214967LP | ROR1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN214967RB | ROR1 - human gene knockout kit via CRISPR, HDR mediated | 1 kit |
$1,657.00
|
|
KN414967 | ROR1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.