SMURF 2 (SMURF2) Human Gene Knockout Kit (CRISPR)

USD 1,290.00


Availability*
2 Weeks

Size
    • 1 kit

Product images

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol SMURF2
Locus ID 64750
Kit Components

KN210866G1, SMURF2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCCGTCAAGCTGCGCCTGAC

KN210866G2, SMURF2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGGCCCGTTCCTCCGGCCTC

KN210866-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet

ACCCTCGGCGGCAGCTCACACCCTCCCTGACTGCCGGTGCCCGCCAGGGCACCCTGCGCGCGCCCGCCGGCCCCGCCCCGGCCCCGCCCCGCCCCGCCGGCCCCGCCTCCCGTCTCCTCCCCGCCCCCCGGAGCCGACGAGTGGCGGCGGCGGCCCCAGGTCCCGGGTCCCTCAGACAAGAGGGCGGGTGGAGGAGGAAGCGGCCGAGCCCAGAGTTCTGCTCCGGCGCCCCCGAGCACCGCCCGCTTCAGCCGACCAGCCCCGTCGGCTACTGGGCCTCGCCGAGACGAGAGGAGGGAAAGGCCTCGGCGGCCGCGAGGAGGCGGCGGGGGCGCGGGCGGAGGCGGCGCGGGCGGCCGCGGCTGCCGCTTTGTTGTGCGGCCCGGGCCGAGGAAGGAGAAGTGGGAGGAGGGGGGAGCTCGGCGTCCCGCTCCCTCCGCGGCTCATGGCGACGACTCTCGGCACATCCGGGACCCTCCGGCCGTGGCGGCCGAGGCGCCGGCTGCTCGGGCCCCAGCCCCGGCCGCTGTGGTGACTCCGCCGCGCCTCGCCGTCGCCCCCGTGCCGCCCGCCGCCCCCGCCGCCCCCGCCGCCGGGGACGTGGGCGAGCTGGCGGGGGGTGCCTGTGGCCTTGGGAAGGGCCAGGGTCGCGATCAATGATGAGTTGGGGGTCGGAGGAATGGGAAGGCCTAGTTCAGGGAGAGTAATTGGAAAACCACTTGCTCTGGTTTGGACATTGTTTAAAAAGCCGAGGATGACTCGGGGCGGGGGGTGGTGTTTTGTGGAGGGGAGAATACACCGGTTCGCATCGCAGGCGGATTTCAGGTCGGAAAGTCTTGGTCAAGGAGCCAGACGCTGCCTCCCGGGGCTCGGGGAACAGCCCCTGGGCTACCGCCCAGGTGAGATCGTGAAGGGGATGAAGAGCTCCCGTGGCGAGGATTATTGAATCCGGTTGCTGACTGCGCGCAGTAAACACTCCTTAAAGATGGAGCGCTTAACGGGAGGGTGTGCGTGTGTGTTCCCGGGTTGTTACCTTGCACACACCCAGTTATGCCCGCATGAAAAACCTTTACTCCCCGCCGCCGGCCACCGCTGCCCGGGCCACACACCTTAAACTCATGTCTCTGAGGTGAGGAGACAGGTTGACTTTTCCGGTGTGCCTGTCTGATCCGACGGCTTGGGCTCATTGTACACTGTGTT

GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_022739
Synonyms DKFZp686F0270; MGC138150
Summary E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Interacts with SMAD1 and SMAD7 in order to trigger their ubiquitination and proteasome-dependent degradation. In addition, interaction with SMAD7 activates autocatalytic degradation, which is prevented by interaction with SCYE1. Forms a stable complex with the TGF-beta receptor-mediated phosphorylated SMAD2 and SMAD3. In this way, SMAD2 may recruit substrates, such as SNON, for ubiquitin-mediated degradation. Enhances the inhibitory activity of SMAD7 and reduces the transcriptional activity of SMAD2. Coexpression of SMURF2 with SMAD1 results in considerable decrease in steady-state level of SMAD1 protein and a smaller decrease of SMAD2 level. [UniProtKB/Swiss-Prot Function]

Citations (2)

Documents

Other Versions

Other products for "SMURF2"
Frequently bought together (2)
SMURF2 mouse monoclonal antibody, clone OTI3E4 (formerly 3E4)
    • 100 ul

USD 379.00


SMURF2 (Myc-DDK-tagged)-Human SMAD specific E3 ubiquitin protein ligase 2 (SMURF2)
    • 10 ug

USD 610.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools