STAT3 Human Gene Knockout Kit (CRISPR)

CAT#: KN204922

STAT3 - human gene knockout kit via CRISPR, HDR mediated

 HDR-mediated knockout kit validation

 Cited in 1 publication.

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Symbol STAT3
Locus ID 6774
Kit Components

KN204922G1, STAT3 gRNA vector 1 in pCas-Guide CRISPR vector, 10 ug, Target Sequence: GCAGCTTGACACACGGTACC

KN204922G2, STAT3 gRNA vector 2 in pCas-Guide CRISPR vector, 10 ug, Target Sequence: AATGGAGCTGCGGCAGTTTC

KN204922-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_003150, NM_139276, NM_213662, XM_005257616, XM_005257617, XM_011525145, XM_011525146, XM_017024972, XM_017024973, XM_017024974, XM_017024975, XM_017024976, XM_057911, XM_171851
Summary The protein encoded by this gene is a member of the STAT protein family. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated through phosphorylation in response to various cytokines and growth factors including IFNs, EGF, IL5, IL6, HGF, LIF and BMP2. This protein mediates the expression of a variety of genes in response to cell stimuli, and thus plays a key role in many cellular processes such as cell growth and apoptosis. The small GTPase Rac1 has been shown to bind and regulate the activity of this protein. PIAS3 protein is a specific inhibitor of this protein. Mutations in this gene are associated with infantile-onset multisystem autoimmune disease and hyper-immunoglobulin E syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2015]

Citations (1)


Other products for "STAT3"
Frequently bought together (4)
anti-STAT3 mouse monoclonal antibody, clone OTI21E7 (formerly 21E7)
    • 100 ul

USD 379.00

STAT3 (Myc-DDK-tagged)-Human signal transducer and activator of transcription 3 (acute-phase response factor) (STAT3), transcript variant 2
    • 10 ug

USD 810.00

STAT3 (Myc-DDK-tagged)-Human signal transducer and activator of transcription 3 (acute-phase response factor) (STAT3), transcript variant 3
    • 10 ug

USD 1,140.00

STAT3 (Myc-DDK-tagged)-Human signal transducer and activator of transcription 3 (acute-phase response factor) (STAT3), transcript variant 1
    • 10 ug

USD 590.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies