TAP1 Human Gene Knockout Kit (CRISPR)

SKU KN204242BN

TAP1 - human gene knockout kit via CRISPR, HDR mediated

Product Data

• Format: 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
• Vector: mBFP-Neo
• Target Symbol: TAP1
• Locus ID: 6890
• Components:

  KN204242G1, TAP1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTCCTCCCCTACTGGCGGCT

  KN204242G2, TAP1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCTGAGCTTCTCGCCAGCGC

  KN204242BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

  GE100003, scramble sequence in pCas-Guide vector

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data

• RefSeq: NM_000593, NM_001292022
• UniProt ID: Q03518
• Synonyms: ABC17; ABCB2; APT1; D6S114E; PSF-1; PSF1; RING4; TAP1 0102N; TAP1N
• Summary: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in the pumping of degraded cytosolic peptides across the endoplasmic reticulum into the membrane-bound compartment where class I molecules assemble. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2014]
• Shipping: Ambient