FOXA2 Human Gene Knockout Kit (CRISPR)

CAT#: KN204066

FOXA2 - human gene knockout kit via CRISPR, HDR mediated

 HDR-mediated knockout kit validation

 Cited in 1 publication.

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Symbol FOXA2
Locus ID 3170
Kit Components

KN204066G1, FOXA2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: AAGGGCACGAGCCGTCCGAC

KN204066G2, FOXA2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CACTCGGCTTCCAGTATGCT

KN204066-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_021784, NM_153675
Synonyms HNF3B; TCF3B
Summary This gene encodes a member of the forkhead class of DNA-binding proteins. These hepatocyte nuclear factors are transcriptional activators for liver-specific genes such as albumin and transthyretin, and they also interact with chromatin. Similar family members in mice have roles in the regulation of metabolism and in the differentiation of the pancreas and liver. This gene has been linked to sporadic cases of maturity-onset diabetes of the young. Transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Oct 2008].

Citations (1)


Other products for "FOXA2"
Frequently bought together (2)
anti-FOXA2 mouse monoclonal antibody, clone OTI3C10 (formerly 3C10)
    • 100 ul

USD 379.00

FOXA2 (Myc-DDK-tagged)-Human forkhead box A2 (FOXA2), transcript variant 2
    • 10 ug

USD 480.00

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
40% off proteins and antibodies
68 Mouse Clones