PTEN Human Gene Knockout Kit (CRISPR)

CAT#: KN202627

PTEN - human gene knockout kit via CRISPR

change donor?

USD 1,290

2 Weeks

    • 1 kit

Product images


Product Data
Symbol PTEN
Locus ID 5728
Kit Components

KN202627G1, PTEN gRNA vector 1 in pCas-Guide vector, Target Sequence: CTGTCACTCTCTTAGAACGT

KN202627G2, PTEN gRNA vector 2 in pCas-Guide vector, Target Sequence: GCAGCCGCAGAAATGGATAC

KN202627-D, donor vector containing Left and right homologous arms and GFP-puro functional cassette.
Homologous arm and GFP-puro sequences

pUC vector backbone in black; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000314
Synonyms 10q23del; BZS; CWS1; DEC; GLM2; MHAM; MMAC1; PTEN1; TEP1
Summary Isoform alpha: Functional kinase, like isoform 1 it antagonizes the PI3K-AKT/PKB signaling pathway. Plays a role in mitochondrial energetic metabolism by promoting COX activity and ATP production, via collaboration with isoform 1 in increasing protein levels of PINK1. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

