OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mouse Pdx1 activation kit by CRISPRa

Be the first to review this product
SKU
GA203166
Pdx1 CRISPRa kit - CRISPR gene activation of mouse pancreatic and duodenal homeobox 1
  $1,657.00
4 Weeks*

Frequently Bought Together (1)

TA355501 Pdx1 Antibody - N-terminal region
100 ul
$585.00

Other products for "Pdx1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol Pdx1
Locus ID 18609
Components

GA203166G1, Pdx1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTACCCTGGAGCCATCAT

GA203166G2, Pdx1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCTCCAGGGTAAACCACGT

GA203166G3, Pdx1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCTCTGGGGCACCCCACG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_008814
UniProt ID P52946
Synonyms IDX-1; IPF-1; Ipf1; Mody4; pdx-1; STF-1
Summary Activates insulin and somatostatin gene transcription. Key regulator of islet peptide hormone expression but also responsible for the development of the pancreas, most probably by determining maturation and differentiation of common pancreatic precursor cells in the developing gut. As part of a PDX1:PBX1b:MEIS2b complex in pancreatic acinar cells is involved in the transcriptional activation of the ELA1 enhancer; the complex binds to the enhancer B element and cooperates with the transcription factor 1 complex (PTF1) bound to the enhancer A element. Binds the DNA sequence 5'-CCCTTAATGGG-3'.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN513070 Pdx1 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products