Mouse Pdx1 activation kit by CRISPRa

SKU GA203166

Pdx1 CRISPRa kit - CRISPR gene activation of mouse pancreatic and duodenal homeobox 1

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: Pdx1
• Locus ID: 18609
• Components:

  GA203166G1, Pdx1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTACCCTGGAGCCATCAT

  GA203166G2, Pdx1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCTCCAGGGTAAACCACGT

  GA203166G3, Pdx1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGCTCTGGGGCACCCCACG

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_008814
• UniProt ID: P52946
• Synonyms: IDX-1; IPF-1; Ipf1; Mody4; pdx-1; STF-1
• Summary: Activates insulin and somatostatin gene transcription. Key regulator of islet peptide hormone expression but also responsible for the development of the pancreas, most probably by determining maturation and differentiation of common pancreatic precursor cells in the developing gut. As part of a PDX1:PBX1b:MEIS2b complex in pancreatic acinar cells is involved in the transcriptional activation of the ELA1 enhancer; the complex binds to the enhancer B element and cooperates with the transcription factor 1 complex (PTF1) bound to the enhancer A element. Binds the DNA sequence 5'-CC[CT]TAATGGG-3'.[UniProtKB/Swiss-Prot Function]