Mouse Muc5ac activation kit by CRISPRa
SKU
GA202762
Muc5ac CRISPRa kit - CRISPR gene activation of mouse mucin 5, subtypes A and C, tracheobronchial/gastric
$1,657.00
2 Weeks*
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
|---|---|
| Target Symbol | Muc5ac |
| Locus ID | 17833 |
| Components |
GA202762G1, Muc5ac gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTCATTTCAGGCTAGTCAA GA202762G2, Muc5ac gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGAGTGGCCACTGTTTACCT GA202762G3, Muc5ac gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCACCCACGTGAAGTCACT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_010844 |
| Synonyms | 2210005L13Rik; MGM |
Write Your Own Review
| Product Manuals |
| FAQs |
| SDS |
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| KN510523 | Muc5ac - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.