Mouse Ascl1 activation kit by CRISPRa

SKU GA202576

Ascl1 CRISPRa kit - CRISPR gene activation of mouse achaete-scute family bHLH transcription factor 1

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: Ascl1
• Locus ID: 17172
• Components:

  GA202576G1, Ascl1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGGAGGGAGCTGAGGAGGT

  GA202576G2, Ascl1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGAAGAGGAGGGGTAGTGG

  GA202576G3, Ascl1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGGTGCGGCCGCCTTTTCAA

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_008553
• UniProt ID: Q02067
• Synonyms: AI225900; ASH1; bHLHa46; Mash1
• Summary: Transcription factor that plays a key role in neuronal differentiation: acts as a pioneer transcription factor, accessing closed chromatin to allow other factors to bind and activate neural pathways (PubMed:24243019). Directly binds the E box motif (5'-CANNTG-3') on promoters and promotes transcription of neuronal genes (PubMed:20107439, PubMed:24243019, PubMed:27281220). The combination of three transcription factors, ASCL1, POU3F2/BRN2 and MYT1L, is sufficient to reprogram fibroblasts and other somatic cells into induced neuronal (iN) cells in vitro (PubMed:20107439, PubMed:24243019, PubMed:27281220). Plays a role at early stages of development of specific neural lineages in most regions of the CNS, and of several lineages in the PNS (PubMed:8217843). Essential for the generation of olfactory and autonomic neurons (PubMed:8221886). Acts synergistically with FOXN4 to specify the identity of V2b neurons rather than V2a from bipotential p2 progenitors during spinal cord neurogenesis, probably through DLL4-NOTCH signaling activation (PubMed:16020526, PubMed:17728344).[UniProtKB/Swiss-Prot Function]