Mouse Lrp1 activation kit by CRISPRa

SKU GA202490

Lrp1 CRISPRa kit - CRISPR gene activation of mouse low density lipoprotein receptor-related protein 1

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: Lrp1
• Locus ID: 16971
• Components:

  GA202490G1, Lrp1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCCGGTAGAGCCAAGGGT

  GA202490G2, Lrp1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTACAAGCTTTGGAGTTCT

  GA202490G3, Lrp1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTCGGAGGCGCTACAAGCTT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_008512
• Synonyms: A2mr; AI316852; b2b1554Clo; CD91; Lrp
• Summary: Endocytic receptor involved in endocytosis and in phagocytosis of apoptotic cells. Required for early embryonic development (PubMed:1423604). Involved in cellular lipid homeostasis. Involved in the plasma clearance of chylomicron remnants and activated LRPAP1 (alpha 2-macroglobulin), as well as the local metabolism of complexes between plasminogen activators and their endogenous inhibitors. May modulate cellular events, such as APP metabolism, kinase-dependent intracellular signaling, neuronal calcium signaling as well as neurotransmission. Acts as an alpha-2-macroglobulin receptor (By similarity).[UniProtKB/Swiss-Prot Function]