OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mouse Lrp1 activation kit by CRISPRa

Be the first to review this product
SKU
GA202490
Lrp1 CRISPRa kit - CRISPR gene activation of mouse low density lipoprotein receptor-related protein 1
  $1,657.00
4 Weeks*

Other products for "Lrp1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol Lrp1
Locus ID 16971
Components

GA202490G1, Lrp1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCCGGTAGAGCCAAGGGT

GA202490G2, Lrp1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTACAAGCTTTGGAGTTCT

GA202490G3, Lrp1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTCGGAGGCGCTACAAGCTT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_008512
Synonyms A2mr; AI316852; b2b1554Clo; CD91; Lrp
Summary Endocytic receptor involved in endocytosis and in phagocytosis of apoptotic cells. Required for early embryonic development (PubMed:1423604). Involved in cellular lipid homeostasis. Involved in the plasma clearance of chylomicron remnants and activated LRPAP1 (alpha 2-macroglobulin), as well as the local metabolism of complexes between plasminogen activators and their endogenous inhibitors. May modulate cellular events, such as APP metabolism, kinase-dependent intracellular signaling, neuronal calcium signaling as well as neurotransmission. Acts as an alpha-2-macroglobulin receptor (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products