Mouse Fut1 activation kit by CRISPRa

SKU GA201485

Fut1 CRISPRa kit - CRISPR gene activation of mouse fucosyltransferase 1

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: Fut1
• Locus ID: 14343
• Components:

  GA201485G1, Fut1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTCCCAGAGCATCTAGCTA

  GA201485G2, Fut1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGTATCCTCTGTATGGACCC

  GA201485G3, Fut1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTTCTCTGACTTGCACGA

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001271981, NM_008051
• UniProt ID: O09160
• Summary: This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is required for the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene impairs development of the olfactory nerve and maturation of the glomerular layer of the main olfactory bulb. Alternative splicing results in multiple transcript variants which encode distinct isoforms. [provided by RefSeq, Dec 2012]