OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mouse Fut1 activation kit by CRISPRa

Be the first to review this product
SKU
GA201485
Fut1 CRISPRa kit - CRISPR gene activation of mouse fucosyltransferase 1
  $1,657.00
4 Weeks*

Frequently Bought Together (1)

TA363197 FUT1 Antibody - C-terminal region
100 ul
$585.00

Other products for "Fut1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol Fut1
Locus ID 14343
Components

GA201485G1, Fut1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTCCCAGAGCATCTAGCTA

GA201485G2, Fut1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGTATCCTCTGTATGGACCC

GA201485G3, Fut1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGTTCTCTGACTTGCACGA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001271981, NM_008051
UniProt ID O09160
Summary This gene is one of three genes in mouse which encode a galactoside 2-L-fucosyltransferase. These genes differ in their developmental- and tissue-specific expression. The encoded type II membrane protein is anchored in the Golgi apparatus and controls the final step in the creation of alpha (1,2) fucosylated carbhohydrates by the addition of a terminal fucose in an alpha (1,2) linkage. This enzyme is required for the synthesis of the Lewis antigen as well as the H-antigen, a precursor of the A and B antigens of the ABH histo-blood group. The biological function of the fucosylated carbhohydrate products is thought to involve cell-adhesion and interactions with microorganisms. Disruption of this gene impairs development of the olfactory nerve and maturation of the glomerular layer of the main olfactory bulb. Alternative splicing results in multiple transcript variants which encode distinct isoforms. provided by RefSeq, Dec 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN506178 Fut1 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products