Human MUC5B activation kit by CRISPRa

SKU GA118892

MUC5B CRISPRa kit - CRISPR gene activation of human mucin 5B, oligomeric mucus/gel-forming

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: MUC5B
• Locus ID: 727897
• Components:

  GA118892G1, MUC5B gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGTGTGTTTGCTCTCGGGGA

  GA118892G2, MUC5B gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGCGTGGCCTGGCCTGGCTT

  GA118892G3, MUC5B gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTACATAAGCTGGGGCCCCC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_002458
• UniProt ID: Q9HC84
• Synonyms: MG1; MUC-5B; MUC5; MUC9
• Summary: This gene encodes a member of the mucin family of proteins, which are highly glycosylated macromolecular components of mucus secretions. This family member is the major gel-forming mucin in mucus. It is a major contributor to the lubricating and viscoelastic properties of whole saliva, normal lung mucus and cervical mucus. This gene has been found to be up-regulated in some human diseases, including sinus mucosa of chronic rhinosinusitis (CRS), CRS with nasal polyposis, chronic obstructive pulmonary disease (COPD) and H. pylori-associated gastric disease, and it may be involved in the pathogenesis of these diseases. [provided by RefSeq, Jul 2010]