Human NLRC5 activation kit by CRISPRa

CAT#: GA113402

NLRC5 CRISPRa kit - CRISPR gene activation of human NLR family CARD domain containing 5

Product Images

Specifications

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Symbol: NLRC5
• Locus ID: 84166
• Kit Components:

  GA113402G1, NLRC5 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCCGCCAGTGCATGGAAC

  GA113402G2, NLRC5 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGGACCCAAGGACAGTCCC

  GA113402G3, NLRC5 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGCAGGGAGCGGGTGTGTT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.

Reference Data

• RefSeq: NM_001330552, NM_032206
• UniProt ID: Q86WI3
• Synonyms: CLR16.1; NOD4; NOD27
• Summary: This gene encodes a member of the caspase recruitment domain-containing NLR family. This gene plays a role in cytokine response and antiviral immunity through its inhibition of NF-kappa-B activation and negative regulation of type I interferon signaling pathways. [provided by RefSeq, Oct 2011]