Human NLRX1 activation kit by CRISPRa

SKU GA112536

NLRX1 CRISPRa kit - CRISPR gene activation of human NLR family member X1

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: NLRX1
• Locus ID: 79671
• Components:

  GA112536G1, NLRX1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACACTCATGCTTGCATACGA

  GA112536G2, NLRX1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGGGTCTGACACCCATTCA

  GA112536G3, NLRX1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGCACCCCAACCTGCTCTT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001282143, NM_001282144, NM_001282358, NM_024618, NM_170722
• UniProt ID: Q86UT6
• Synonyms: CLR11.3; DLNB26; NOD5; NOD9; NOD26
• Summary: The protein encoded by this gene is a member of the NLR family and localizes to the outer mitochondrial membrane. The encoded protein is a regulator of mitochondrial antivirus responses. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2013]