Human FTO activation kit by CRISPRa

SKU GA112344

FTO CRISPRa kit - CRISPR gene activation of human FTO alpha-ketoglutarate dependent dioxygenase

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: FTO
• Locus ID: 79068
• Components:

  GA112344G1, FTO gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAAGTGAGCCCGACTTTCCA

  GA112344G2, FTO gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCACGGTGCACTCTAGGA

  GA112344G3, FTO gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCAGGGCGACGGCACACCC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001080432, NM_001363905, NM_001363988, NM_001363891, NM_001363894, NM_001363896, NM_001363897, NM_001363898, NM_001363899, NM_001363900, NM_001363901, NM_001363903, NR_156761
• UniProt ID: Q9C0B1
• Synonyms: ALKBH9; BMIQ14; GDFD
• Summary: This gene is a nuclear protein of the AlkB related non-haem iron and 2-oxoglutarate-dependent oxygenase superfamily but the exact physiological function of this gene is not known. Other non-heme iron enzymes function to reverse alkylated DNA and RNA damage by oxidative demethylation. Studies in mice and humans indicate a role in nervous and cardiovascular systems and a strong association with body mass index, obesity risk, and type 2 diabetes. [provided by RefSeq, Jul 2011]