OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human SLC41A3 activation kit by CRISPRa

Be the first to review this product
SKU
GA110393
SLC41A3 CRISPRa kit - CRISPR gene activation of human solute carrier family 41 member 3
  $1,657.00
4 Weeks*

Frequently Bought Together (1)

RC202286 SLC41A3 (Myc-DDK-tagged)-Human solute carrier family 41, member 3 (SLC41A3), transcript variant 1
10 ug
$472.00

Other products for "SLC41A3"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol SLC41A3
Locus ID 54946
Components

GA110393G1, SLC41A3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTATAAGTGGCACGTGCTA

GA110393G2, SLC41A3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTGACCCTATGGAGACACC

GA110393G3, SLC41A3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGGCAAAGCCTCGAGCAC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001008485, NM_001008486, NM_001008487, NM_001164475, NM_017836
UniProt ID Q96GZ6
Synonyms SLC41A1-L2
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN402286 SLC41A3 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products