Human SRRM2 activation kit by CRISPRa
SKU
GA108368
SRRM2 CRISPRa kit - CRISPR gene activation of human serine/arginine repetitive matrix 2
$1,657.00
2 Weeks*
| Product Data | |
| Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
|---|---|
| Target Symbol | SRRM2 |
| Locus ID | 23524 |
| Components |
GA108368G1, SRRM2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCTCCGTTCTTCGTTGCAC GA108368G2, SRRM2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTCGTTGCACTGGCCAAC GA108368G3, SRRM2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCTTAGTCTTTCGGCAAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
| OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_016333 |
| UniProt ID | Q9UQ35 |
| Synonyms | 300-KD; Cwc21; CWF21; HSPC075; SRL300; SRm300 |
| Summary | Required for pre-mRNA splicing as component of the spliceosome.[UniProtKB/Swiss-Prot Function] |
Write Your Own Review
| Product Manuals |
| FAQs |
| SDS |
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| KN413828 | SRRM2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.