OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human SRRM2 activation kit by CRISPRa

Be the first to review this product
SKU
GA108368
SRRM2 CRISPRa kit - CRISPR gene activation of human serine/arginine repetitive matrix 2
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA355586 SRRM2 Antibody - C-terminal region
100 ul
$585.00
RC213828 SRRM2 (Myc-DDK-tagged)-Human serine/arginine repetitive matrix 2 (SRRM2)
10 ug
$2,230.00

Other products for "SRRM2"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol SRRM2
Locus ID 23524
Components

GA108368G1, SRRM2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCTCCGTTCTTCGTTGCAC

GA108368G2, SRRM2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTTCGTTGCACTGGCCAAC

GA108368G3, SRRM2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCTTAGTCTTTCGGCAAC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_016333
UniProt ID Q9UQ35
Synonyms 300-KD; Cwc21; CWF21; HSPC075; SRL300; SRm300
Summary Required for pre-mRNA splicing as component of the spliceosome.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN413828 SRRM2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products