Human WWP2 activation kit by CRISPRa

SKU GA107599

WWP2 CRISPRa kit - CRISPR gene activation of human WW domain containing E3 ubiquitin protein ligase 2

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: WWP2
• Locus ID: 11060
• Components:

  GA107599G1, WWP2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCATCAACCTTATAGAGGC

  GA107599G2, WWP2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGGGTTTCTGCTCACCGGA

  GA107599G3, WWP2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGATAAAAAGGCCTCCTCG

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001270453, NM_001270454, NM_001270455, NM_007014, NM_199423, NM_199424
• UniProt ID: O00308
• Synonyms: AIP2; WWp2-like
• Summary: This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012]