OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human WWP2 activation kit by CRISPRa

Be the first to review this product
SKU
GA107599
WWP2 CRISPRa kit - CRISPR gene activation of human WW domain containing E3 ubiquitin protein ligase 2
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA329808 Rabbit Polyclonal Anti-WWP2 Antibody
100 ul
$585.00
RC223118 WWP2 (Myc-DDK-tagged)-Human WW domain containing E3 ubiquitin protein ligase 2 (WWP2), transcript variant 1
10 ug
$797.00

Other products for "WWP2"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol WWP2
Locus ID 11060
Components

GA107599G1, WWP2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCATCAACCTTATAGAGGC

GA107599G2, WWP2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGGGTTTCTGCTCACCGGA

GA107599G3, WWP2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGATAAAAAGGCCTCCTCG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001270453, NM_001270454, NM_001270455, NM_007014, NM_199423, NM_199424
UniProt ID O00308
Synonyms AIP2; WWp2-like
Summary This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. provided by RefSeq, Jul 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN409529 WWP2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products