Human Cardiac Troponin T (TNNT2) activation kit by CRISPRa

SKU GA104931

TNNT2 CRISPRa kit - CRISPR gene activation of human troponin T2, cardiac type

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: TNNT2
• Locus ID: 7139
• Components:

  GA104931G1, Cardiac Troponin T gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGGACCACATGGGCTTATA

  GA104931G2, Cardiac Troponin T gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCACGCCATATAAGCCCATG

  GA104931G3, Cardiac Troponin T gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTGCCAGGGACAAGGCTAC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_000364, NM_001001430, NM_001001431, NM_001001432, NM_001276345, NM_001276346, NM_001276347
• UniProt ID: P45379
• Synonyms: CMD1D; CMH2; CMPD2; cTnT; LVNC6; RCM3; TnTC
• Summary: The protein encoded by this gene is the tropomyosin-binding subunit of the troponin complex, which is located on the thin filament of striated muscles and regulates muscle contraction in response to alterations in intracellular calcium ion concentration. Mutations in this gene have been associated with familial hypertrophic cardiomyopathy as well as with dilated cardiomyopathy. Transcripts for this gene undergo alternative splicing that results in many tissue-specific isoforms, however, the full-length nature of some of these variants has not yet been determined. [provided by RefSeq, Jul 2008]