Human Kallikrein 6 (KLK6) activation kit by CRISPRa

SKU GA103832

KLK6 CRISPRa kit - CRISPR gene activation of human kallikrein related peptidase 6

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: KLK6
• Locus ID: 5653
• Components:

  GA103832G1, Kallikrein 6 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAAAGGAGGACTGTCAGAC

  GA103832G2, Kallikrein 6 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCCTCAACCTCTCTTCCGG

  GA103832G3, Kallikrein 6 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACAAAGCCCGATTGTTCCT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001012964, NM_001012965, NM_001012966, NM_001319948, NM_001319949, NM_002774
• UniProt ID: Q92876
• Synonyms: Bssp; hK6; Klk7; PRSS9; PRSS18; SP59
• Summary: This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. The encoded preproprotein is proteolytically processed to generate the mature protease. Expression of this protease is regulated by steroid hormones and may be elevated in multiple human cancers and in serum from psoriasis patients. The encoded protease may participate in the cleavage of amyloid precursor protein and alpha-synuclein, thus implicating this protease in Alzheimer's and Parkinson's disease, respectively. This gene is located in a gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]