Human Perilipin-1 (PLIN1) activation kit by CRISPRa

SKU GA103605

PLIN1 CRISPRa kit - CRISPR gene activation of human perilipin 1

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: PLIN1
• Locus ID: 5346
• Components:

  GA103605G1, Perilipin-1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATACTAAGTCCTCTGAGCC

  GA103605G2, Perilipin-1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTCATATAACCATGACAAC

  GA103605G3, Perilipin-1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAACAATTCCTGTCACTCC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001145311, NM_002666
• UniProt ID: O60240
• Synonyms: FPLD4; PERI; PLIN
• Summary: The protein encoded by this gene coats lipid storage droplets in adipocytes, thereby protecting them until they can be broken down by hormone-sensitive lipase. The encoded protein is the major cAMP-dependent protein kinase substrate in adipocytes and, when unphosphorylated, may play a role in the inhibition of lipolysis. Alternatively spliced transcript variants varying in the 5' UTR, but encoding the same protein, have been found for this gene. [provided by RefSeq, Feb 2009]