Human Polycystin 2 (PKD2) activation kit by CRISPRa
SKU
GA103573
PKD2 CRISPRa kit - CRISPR gene activation of human polycystin 2, transient receptor potential cation channel
$1,657.00
2 Weeks*
Product Data | |
Format | 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug) |
---|---|
Target Symbol | PKD2 |
Locus ID | 5311 |
Components |
GA103573G1, Polycystin 2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCTGCCTCGATTCACCAAA GA103573G2, Polycystin 2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCAAGAGTTATCTCAGCGT GA103573G3, Polycystin 2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCACTTGGAACGCGGACTC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077 |
OTI Disclaimer | These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc. |
Shipping | Ambient |
Reference Data | |
RefSeq | NM_000297, NR_156488 |
UniProt ID | Q13563 |
Synonyms | APKD2; Pc-2; PC2; PKD4; TRPP2 |
Summary | This gene encodes a member of the polycystin protein family. The encoded protein is a multi-pass membrane protein that functions as a calcium permeable cation channel, and is involved in calcium transport and calcium signaling in renal epithelial cells. This protein interacts with polycystin 1, and they may be partners in a common signaling cascade involved in tubular morphogenesis. Mutations in this gene are associated with autosomal dominant polycystic kidney disease type 2. [provided by RefSeq, Mar 2011] |
Write Your Own Review
Product Manuals |
FAQs |
SDS |
SKU | Description | Size | Price | |
---|---|---|---|---|
KN420948 | PKD2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. | 1 kit |
$1,657.00
|
|
Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.