Human MYH10 activation kit by CRISPRa

SKU GA103070

MYH10 CRISPRa kit - CRISPR gene activation of human myosin heavy chain 10

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: MYH10
• Locus ID: 4628
• Components:

  GA103070G1, MYH10 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGCCAAACCCTGTGCGCAT

  GA103070G2, MYH10 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGAGTCCTGACGTCACCCC

  GA103070G3, MYH10 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGCTGCGACTCACCTGCAGT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001256012, NM_001256095, NM_005964
• UniProt ID: P35580
• Synonyms: NMMHC-IIB; NMMHCB
• Summary: This gene encodes a member of the myosin superfamily. The protein represents a conventional non-muscle myosin; it should not be confused with the unconventional myosin-10 (MYO10). Myosins are actin-dependent motor proteins with diverse functions including regulation of cytokinesis, cell motility, and cell polarity. Mutations in this gene have been associated with May-Hegglin anomaly and developmental defects in brain and heart. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]