Human Mucin 5AC (MUC5AC) activation kit by CRISPRa

SKU GA103036

MUC5AC CRISPRa kit - CRISPR gene activation of human mucin 5AC, oligomeric mucus/gel-forming

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: MUC5AC
• Locus ID: 4586
• Components:

  GA103036G1, Mucin 5AC gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCCAGCCCCGTGCTTCACGT

  GA103036G2, Mucin 5AC gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCCCTCACCCAAGTAAACAG

  GA103036G3, Mucin 5AC gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTGGGTGAGGGGGAACCAC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_001304359, NM_017511
• UniProt ID: P98088
• Synonyms: leB; MUC5; mucin; TBM
• Summary: Gel-forming glycoprotein of gastric and respiratoy tract epithelia that protects the mucosa from infection and chemical damage by binding to inhaled microrganisms and particles that are subsequently removed by the mucocilary system.[UniProtKB/Swiss-Prot Function]