OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human MUC2 activation kit by CRISPRa

Be the first to review this product
SKU
GA103033
MUC2 CRISPRa kit - CRISPR gene activation of human mucin 2, oligomeric mucus/gel-forming
  $1,657.00
4 Weeks*

Frequently Bought Together (1)

TA378798 MUC2 Rabbit polyclonal Antibody
100 ul
$410.00

Other products for "MUC2"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol MUC2
Locus ID 4583
Components

GA103033G1, MUC2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTCTGGTCCTTATATGTCC

GA103033G2, MUC2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGATGCCACACCCACCCT

GA103033G3, MUC2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGGGTGTGTGTTGGCATTC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_002457
Synonyms MLP; MUC-2; SMUC
Summary This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. provided by RefSeq, Oct 2016
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN413812 MUC2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products