Human MUC2 activation kit by CRISPRa

SKU GA103033

MUC2 CRISPRa kit - CRISPR gene activation of human mucin 2, oligomeric mucus/gel-forming

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: MUC2
• Locus ID: 4583
• Components:

  GA103033G1, MUC2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTCTGGTCCTTATATGTCC

  GA103033G2, MUC2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGATGCCACACCCACCCT

  GA103033G3, MUC2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCGGGTGTGTGTTGGCATTC

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_002457
• Synonyms: MLP; MUC-2; SMUC
• Summary: This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]