Human MSH3 activation kit by CRISPRa

SKU
GA102978
MSH3 CRISPRa kit - CRISPR gene activation of human mutS homolog 3
$1,657.00
2 Weeks*
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol MSH3
Locus ID 4437
Components

GA102978G1, MSH3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGCCTCGCCTGCACAAAT

GA102978G2, MSH3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTGCTGTAACGAGCGGGCT

GA102978G3, MSH3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGAACGCGCGGTCAAGTT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_002439
UniProt ID P20585
Synonyms DUP; FAP4; MRP1
Summary The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
Write Your Own Review
You're reviewing:Human MSH3 activation kit by CRISPRa
Your Rating
SKU Description Size Price
KN412391 MSH3 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.