Human MSH3 activation kit by CRISPRa

SKU GA102978

MSH3 CRISPRa kit - CRISPR gene activation of human mutS homolog 3

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: MSH3
• Locus ID: 4437
• Components:

  GA102978G1, MSH3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGCCTCGCCTGCACAAAT

  GA102978G2, MSH3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCTGCTGTAACGAGCGGGCT

  GA102978G3, MSH3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAGAACGCGCGGTCAAGTT

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_002439
• UniProt ID: P20585
• Synonyms: DUP; FAP4; MRP1
• Summary: The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]