OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human Leptin (LEP) activation kit by CRISPRa

Be the first to review this product
SKU
GA102677
LEP CRISPRa kit - CRISPR gene activation of human leptin
  $1,657.00
4 Weeks*

Frequently Bought Together (1)

RC209259 LEP (Myc-DDK-tagged)-Human leptin (LEP)
10 ug
$300.00

Other products for "LEP"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol LEP
Locus ID 3952
Components

GA102677G1, Leptin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAGCCACGCGCGCACCCT

GA102677G2, Leptin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATAGTCGCGCCGGAGCCTC

GA102677G3, Leptin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACGTCGCTACCCTGAGGGG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_000230
UniProt ID P41159
Synonyms LEPD; OB; OBS
Summary This gene encodes a protein that is secreted by white adipocytes into the circulation and plays a major role in the regulation of energy homeostasis. Circulating leptin binds to the leptin receptor in the brain, which activates downstream signaling pathways that inhibit feeding and promote energy expenditure. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis, reproduction, bone formation and wound healing. Mutations in this gene and its regulatory regions cause severe obesity and morbid obesity with hypogonadism in human patients. A mutation in this gene has also been linked to type 2 diabetes mellitus development. provided by RefSeq, Aug 2017
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN409259 LEP - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products