Human Leptin (LEP) activation kit by CRISPRa

SKU GA102677

LEP CRISPRa kit - CRISPR gene activation of human leptin

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: LEP
• Locus ID: 3952
• Components:

  GA102677G1, Leptin gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAGCCACGCGCGCACCCT

  GA102677G2, Leptin gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATAGTCGCGCCGGAGCCTC

  GA102677G3, Leptin gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CACGTCGCTACCCTGAGGGG

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_000230
• UniProt ID: P41159
• Synonyms: LEPD; OB; OBS
• Summary: This gene encodes a protein that is secreted by white adipocytes into the circulation and plays a major role in the regulation of energy homeostasis. Circulating leptin binds to the leptin receptor in the brain, which activates downstream signaling pathways that inhibit feeding and promote energy expenditure. This protein also has several endocrine functions, and is involved in the regulation of immune and inflammatory responses, hematopoiesis, angiogenesis, reproduction, bone formation and wound healing. Mutations in this gene and its regulatory regions cause severe obesity and morbid obesity with hypogonadism in human patients. A mutation in this gene has also been linked to type 2 diabetes mellitus development. [provided by RefSeq, Aug 2017]