Human GEM activation kit by CRISPRa

SKU GA101781

GEM CRISPRa kit - CRISPR gene activation of human GTP binding protein overexpressed in skeletal muscle

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: GEM
• Locus ID: 2669
• Components:

  GA101781G1, GEM gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAAAGCACTTGCGAGCTGT

  GA101781G2, GEM gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTCGGAGTTGCAGCCACT

  GA101781G3, GEM gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACGTCACGGAAAAGCCCCG

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_005261, NM_181702
• UniProt ID: P55040
• Synonyms: KIR
• Summary: The protein encoded by this gene belongs to the RAD/GEM family of GTP-binding proteins. It is associated with the inner face of the plasma membrane and could play a role as a regulatory protein in receptor-mediated signal transduction. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]