Human GEM activation kit by CRISPRa

SKU
GA101781
GEM CRISPRa kit - CRISPR gene activation of human GTP binding protein overexpressed in skeletal muscle
$1,657.00
2 Weeks*
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol GEM
Locus ID 2669
Components

GA101781G1, GEM gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCAAAGCACTTGCGAGCTGT

GA101781G2, GEM gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTCGGAGTTGCAGCCACT

GA101781G3, GEM gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACGTCACGGAAAAGCCCCG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077

OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_005261, NM_181702
UniProt ID P55040
Synonyms KIR
Summary The protein encoded by this gene belongs to the RAD/GEM family of GTP-binding proteins. It is associated with the inner face of the plasma membrane and could play a role as a regulatory protein in receptor-mediated signal transduction. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Write Your Own Review
You're reviewing:Human GEM activation kit by CRISPRa
Your Rating
SKU Description Size Price
KN405286 GEM - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.