Human FUT2 activation kit by CRISPRa

SKU GA101673

FUT2 CRISPRa kit - CRISPR gene activation of human fucosyltransferase 2

Product Data

• Format: 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
• Target Symbol: FUT2
• Locus ID: 2524
• Components:

  GA101673G1, FUT2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTCCCCAAGGAAGACCCTCG

  GA101673G2, FUT2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACAAGGTCGCATCCCCCATC

  GA101673G3, FUT2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGGACTTTGTGGCCGGCAA

  1 CRISPRa-Enhancer vector, SKU GE100056

  1 CRISPRa scramble vector, SKU GE100077

• OTI Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
• Shipping: Ambient

Reference Data

• RefSeq: NM_000511, NM_001097638
• UniProt ID: Q10981
• Synonyms: B12QTL1; SE; Se2; SEC2; sej
• Summary: The protein encoded by this gene is a Golgi stack membrane protein that is involved in the creation of a precursor of the H antigen, which is required for the final step in the soluble A and B antigen synthesis pathway. This gene is one of two encoding the galactoside 2-L-fucosyltransferase enzyme. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]